pUC19-URA3-3'SEC13-GFP
              
              
                (Plasmid
                
                #25445)
              
            
            
            
          - 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepUC19-URA3
- Backbone size w/o insert (bp) 4500
- 
              Vector typeYeast Expression
- 
                Selectable markersURA3
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameSec13-Green Fluorescent Protein
- 
                  Alt nameSec13-GFP
- 
                    SpeciesS. cerevisiae (budding yeast); Aequoria victoria
- 
                  Insert Size (bp)1200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer ggaagggcgatcggtgcgggcctcttcg (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pUC19-URA3-3'SEC13-GFP was a gift from Benjamin Glick (Addgene plasmid # 25445 ; http://n2t.net/addgene:25445 ; RRID:Addgene_25445)
- 
                For your References section: Golgi structure correlates with transitional endoplasmic reticulum organization in Pichia pastoris and Saccharomyces cerevisiae. Rossanese OW, Soderholm J, Bevis BJ, Sears IB, O'Connor J, Williamson EK, Glick BS. J Cell Biol. 1999 Apr 5. 145(1):69-81. 10.1083/jcb.145.1.69 PubMed 10189369
 
    
 
                         
             
            