Skip to main content
Addgene
Open Menu

pGEX6p1_GST-HRV3C-DmrB-[dltCARD]mCasp1(E102D103TEV)-8xHis (KS585)
(Plasmid #254943)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254943 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pGEX6p1
  • Backbone size w/o insert (bp) 4966
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Casp1
  • Alt name
    Interleukin-1 beta convertase (Il1bc)
  • Alt name
    Interleukin-1 beta-converting enzyme (ICE)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1296
  • Mutation
    E102D103TEV
  • Entrez Gene
    Casp1 (a.k.a. ICE, Il1bc)
  • Promoter tac
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • 8xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pGEX_MCS_seq_fw (GGGCTGGCAAGCCACGTTTGGTG)
  • 3′ sequencing primer pGEX_MCS_seq_rv (CACCGAAACGCGCGAGGCAGATC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert has a STOP but no START (N-terminal GST fusion).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6p1_GST-HRV3C-DmrB-[dltCARD]mCasp1(E102D103TEV)-8xHis (KS585) was a gift from Kate Schroder (Addgene plasmid # 254943 ; http://n2t.net/addgene:254943 ; RRID:Addgene_254943)

  • For your References section:

    Caspase-1 self-cleavage is an intrinsic mechanism to terminate inflammasome activity. Boucher D, Monteleone M, Coll RC, Chen KW, Ross CM, Teo JL, Gomez GA, Holley CL, Bierschenk D, Stacey KJ, Yap AS, Bezbradica JS, Schroder K. J Exp Med. 2018 Mar 5;215(3):827-840. doi: 10.1084/jem.20172222. Epub 2018 Feb 6. 10.1084/jem.20172222 PubMed 29432122
Related items: