pCDF1-p18INK4c
(Plasmid
#25650)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDF1-MCS2-EF1-Puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 6606
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep18INK4c
-
Alt nameCDKN2C
-
Alt namep18
-
Alt nameINK4c
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1350
-
GenBank IDNM_001262
-
Entrez GeneCDKN2C (a.k.a. INK4C, p18, p18-INK4C)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atccacgctgttttgacctc
- 3′ sequencing primer ccaacttctcggggactgt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF1-p18INK4c was a gift from Todd Waldman (Addgene plasmid # 25650 ; http://n2t.net/addgene:25650 ; RRID:Addgene_25650) -
For your References section:
Identification of p18 INK4c as a tumor suppressor gene in glioblastoma multiforme. Solomon DA, Kim JS, Jenkins S, Ressom H, Huang M, Coppa N, Mabanta L, Bigner D, Yan H, Jean W, Waldman T. Cancer Res. 2008 Apr 15. 68(8):2564-9. 10.1158/0008-5472.CAN-07-6388 PubMed 18381405