pSLIK-Venus-TmiR-G13-G12
(Plasmid
#25742)
-
PurposeLentiviral vector with Tet-based inducible expression of both mouse G alpha 12 and G alpha 13 miR30-based shRNAs, constitutive Venus fluorescent protein coexpression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 25742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser
- Backbone size w/o insert (bp) 12752
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameG alpha 13 and 12 miR-shRNA
-
SpeciesM. musculus (mouse)
-
Tag
/ Fusion Protein
- Venus (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CMV-F
- 3′ sequencing primer EXFP-R, hUBCpro-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byrtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL Venus- Tobias Meyer, Stanford
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSLIK-Venus with G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-Venus-TmiR-G13-G12 was a gift from Iain Fraser (Addgene plasmid # 25742 ; http://n2t.net/addgene:25742 ; RRID:Addgene_25742) -
For your References section:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906