pSLIK-Neo-TmiR-Gb2
(Plasmid
#25744)
-
PurposeControl lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA, constitutive Neomycin resistance gene coexpression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser
- Backbone size w/o insert (bp) 12486
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsTop10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGb2
-
Alt nameG beta 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)22
-
Entrez GeneGnb2 (a.k.a. Gnb-2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuA1 (unknown if destroyed)
- 3′ cloning site BfuA1 (unknown if destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer Neo-R, hUBCpro-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byrtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSLIK-Neo with TRE-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-Neo-TmiR-Gb2 was a gift from Iain Fraser (Addgene plasmid # 25744 ; http://n2t.net/addgene:25744 ; RRID:Addgene_25744) -
For your References section:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906