Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLIK-Neo-TGmiR-Gb2
(Plasmid #25746)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 25746 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSLIK
  • Backbone manufacturer
    Iain Fraser
  • Backbone size w/o insert (bp) 13217
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gb2
  • Alt name
    G beta 2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    22
  • Entrez Gene
    Gnb2 (a.k.a. Gnb-2)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuA1 (unknown if destroyed)
  • 3′ cloning site BfuA1 (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer Neo-R, hUBCpro-R
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    rtTA- Atze Das, University of Amsterdam; TRE promoter- David Anderson, Caltech; miR30- Greg Hannon, CSHL

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo

GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-Neo-TGmiR-Gb2 was a gift from Iain Fraser (Addgene plasmid # 25746 ; http://n2t.net/addgene:25746 ; RRID:Addgene_25746)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906