Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #25735)


Item Catalog # Description Quantity Price (USD)
Plasmid 25735 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Iain Fraser
  • Backbone size (bp) 13286
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    DB3.1 (ccdB survival)
  • Copy number


  • Gene/Insert name

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR1 (not destroyed)
  • 3′ cloning site attR2 (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer hUBCpro-R (CTAAGGCCGAGTCTTATGAGCAG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Parent lentivector, co-expression of Neomycin selection gene

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-Neo was a gift from Iain Fraser (Addgene plasmid # 25735)
  • For your References section:

    A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 PubMed 16945906