Skip to main content
Addgene

(E6) CMV-p18 C/EBPalpha
(Plasmid #25881)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 25881 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 (+)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5428
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p18 C/EBPalpha
  • Alt name
    Cebpa
  • Alt name
    C/EBP alpha conserved region 4
  • Species
    M. musculus (mouse)
  • Mutation
    N-terminal truncation, contains only CR4 and bZIP domains.
  • GenBank ID
    NM_007678
  • Entrez Gene
    Cebpa (a.k.a. C/ebpalpha, CBF-A, Cebp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site.

p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    (E6) CMV-p18 C/EBPalpha was a gift from Ormond MacDougald (Addgene plasmid # 25881 ; http://n2t.net/addgene:25881 ; RRID:Addgene_25881)
  • For your References section:

    p300 coactivates the adipogenic transcription factor CCAAT/enhancer-binding protein alpha. Erickson RL, Hemati N, Ross SE, MacDougald OA. J Biol Chem. 2001 May 11. 276(19):16348-55. PubMed 11340085