(E6) CMV-p18 C/EBPalpha
(Plasmid #25881)

• Depositing Lab: Ormond MacDougald
• Publication: Erickson et al J Biol Chem. 2001 May 11. 276(19):16348-55.

Backbone

• Vector backbone: pcDNA3.1 (+)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5428
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: p18 C/EBPalpha
• Alt name: Cebpa
• Alt name: C/EBP alpha conserved region 4
• Species: M. musculus (mouse)
• Mutation: N-terminal truncation, contains only CR4 and bZIP domains.
• GenBank ID: NM_007678
• Entrez Gene: Cebpa (a.k.a. C/ebpalpha, CBF-A, Cebp)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: BGH-rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To create a non-His-tagged form of CR4, His-p18C/EBPα was linearized with HindIII, and a fill-in reaction was performed to blunt end the vector. The linearized vector was then digested with BglII, and the resulting fragment was subcloned into the BamHI-EcoRV site of pcDNA3.1(+) (Invitrogen) containing an ideal Kozak consensus sequence oligonucleotide (AGCTTGCGGCCGCCACCATGGG) 5′ to theBamHI site.

p18 refers to the fact that this is an N-terminally truncated His fusion corresponding to roughly 18kDa.