pBMTBX-1
(Plasmid
#26072)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBMTBX-1
- Backbone size (bp) 5120
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
GenBank IDGQ438218
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site HincII (unknown if destroyed)
- 5′ sequencing primer acctgacgctttttatcgca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMTBX-1 was a gift from Ryan Gill (Addgene plasmid # 26072 ; http://n2t.net/addgene:26072 ; RRID:Addgene_26072) -
For your References section:
Broad-host-range vectors for protein expression across gram negative hosts. Prior JE, Lynch MD, Gill RT. Biotechnol Bioeng. 2010 Jun 1. 106(2):326-32. 10.1002/bit.22695 PubMed 20148414