Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFBOH-LIC
(Plasmid #26099)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26099 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pFBOH-LIC
  • Backbone manufacturer
    Structural Genomics Consortium
  • Backbone size (bp) 6770
  • Vector type
    Baculovirus expression
  • Selectable markers
    Gentamicin
  • Tags / Fusion Proteins
    • 6x His (N terminal on backbone)
    • Thrombin protease cleavage site (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Promoter polyhedrin

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer Polyhedrin forward, pFBOH-Fwd (CCGGATTATTCATACCGTCCCACCA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-LIC was a gift from Cheryl Arrowsmith (Addgene plasmid # 26099 ; http://n2t.net/addgene:26099 ; RRID:Addgene_26099)