pFBOH-LIC
(Plasmid
#26099)
-
Purpose(Empty Backbone) SGC Empty baculovirus expression/transfer vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepFBOH-LIC
-
Backbone manufacturerStructural Genomics Consortium
- Backbone size (bp) 6770
-
Vector typeBaculovirus expression
-
Selectable markersGentamicin
-
Tags
/ Fusion Proteins
- 6x His (N terminal on backbone)
- Thrombin protease cleavage site (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
- Promoter polyhedrin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer Polyhedrin forward, pFBOH-Fwd (CCGGATTATTCATACCGTCCCACCA)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBOH-LIC was a gift from Cheryl Arrowsmith (Addgene plasmid # 26099 ; http://n2t.net/addgene:26099 ; RRID:Addgene_26099)