-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBPGUw
- Backbone size w/o insert (bp) 9052
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2646
-
Entrez GeneGAL4 (a.k.a. YPL248C, GAL81)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer DSCP F: GAGCTCGCCCGGGGATC
- 3′ sequencing primer GAL4 R: CGGCATCCTTGTTGACGTTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results identified a second GAL4 ORF in the plasmid sequence. This second ORF is not expected to affect plasmid function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPGAL4.1Uw was a gift from Gerald Rubin (Addgene plasmid # 26226 ; http://n2t.net/addgene:26226 ; RRID:Addgene_26226) -
For your References section:
Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Aug 9. ():. 10.1534/genetics.110.119917 PubMed 20697123