-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBPGUw
- Backbone size w/o insert (bp) 8778
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsccdB Survival 2T1 strain (Invitrogen), or equivalent, must be used to propagate plasmids carrying the ccdB gene.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL4::p65
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast)
-
Insert Size (bp)1260
-
Entrez GeneRELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer DSCP F: GAGCTCGCCCGGGGATC
- 3′ sequencing primer GAL4 R: CGGCATCCTTGTTGACGTTAT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPGAL4.2::p65Uw was a gift from Gerald Rubin (Addgene plasmid # 26229 ; http://n2t.net/addgene:26229 ; RRID:Addgene_26229) -
For your References section:
Refinement of tools for targeted gene expression in Drosophila. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Genetics. 2010 Oct;186(2):735-55. doi: 10.1534/genetics.110.119917. Epub 2010 Aug 9. 10.1534/genetics.110.119917 PubMed 20697123