Skip to main content

pXN-FBLWLF-GAL80
(Plasmid #26265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26265 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXN-FBLWLF
  • Backbone size w/o insert (bp) 8757
  • Vector type
    Bacterial Expression, Insect Expression ; Drosophila transgenesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAL80
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1325
  • Entrez Gene
    GAL80 (a.k.a. YML051W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer CAGTGCACGTTTGCTTGTTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    From pCASPTubGAL80 (from Lee and Luo. 1999. Neuron. 22, 451-461)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXN-FBLWLF-GAL80 was a gift from Tom Clandinin (Addgene plasmid # 26265 ; http://n2t.net/addgene:26265 ; RRID:Addgene_26265)
  • For your References section:

    A versatile in vivo system for directed dissection of gene expression patterns. Gohl DM, Silies MA, Gao XJ, Bhalerao S, Luongo FJ, Lin CC, Potter CJ, Clandinin TR. Nat Methods. 2011 Mar;8(3):231-7. doi: 10.1038/nmeth.1561. 10.1038/nmeth.1561 PubMed 21473015