pRecA-YFP-mCherry
(Plasmid #263234)

• Purpose: recA promoter driving expression of YFP reporter and constitutive expression of mCherry reporter
• Depositing Lab: Amir Mitchell
• Depositing Organization: University of Massachusetts, Worcester
  Located in the United States of America
• Publication: pRecA-YFP-mCherry (unpublished)

Backbone

• Vector backbone: pZS4*5noO1+11-CFP
• Backbone size w/o insert (bp): 3701
• Total vector size (bp): 5447
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Also resistant to streptomycin
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: YFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: recA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cttcaccctctccactgacag

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: EM7

Cloning Information for Gene/Insert 2

• Cloning method: Gene Synthesis
• 5′ sequencing primer: gttatcctcctcgcccttg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mCherry, YFP and backbone was received from Robert Brewster from University of Massachusetts Worcester

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry