-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSox2 shRNA
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer LKO1-5 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SOX2a shRNA sequence - CGAGATAAACATGGCAATCAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 Sox2 HM a was a gift from Matthew Meyerson (Addgene plasmid # 26353 ; http://n2t.net/addgene:26353 ; RRID:Addgene_26353) -
For your References section:
SOX2 is an amplified lineage-survival oncogene in lung and esophageal squamous cell carcinomas. Bass AJ, Watanabe H, Mermel CH, Yu S, Perner S, Verhaak RG, Kim SY, Wardwell L, Tamayo P, Gat-Viks I, Ramos AH, Woo MS, Weir BA, Getz G, Beroukhim R, O'Kelly M, Dutt A, Rozenblatt-Rosen O, Dziunycz P, Komisarof J, Chirieac LR, Lafargue CJ, Scheble V, Wilbertz T, Ma C, Rao S, Nakagawa H, Stairs DB, Lin L, Giordano TJ, Wagner P, Minna JD, Gazdar AF, Zhu CQ, Brose MS, Cecconello I, Jr UR, Marie SK, Dahl O, Shivdasani RA, Tsao MS, Rubin MA, Wong KK, Regev A, Hahn WC, Beer DG, Rustgi AK, Meyerson M. Nat Genet. 2009 Nov . 41(11):1238-42. 10.1038/ng.465 PubMed 19801978