Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #30323)


Item Catalog # Description Quantity Price (USD)
Plasmid 30323 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pLKO.1 puro
  • Backbone manufacturer
    Available at Addgene (#8453)
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    GFP shRNA
  • Alt name

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

shRNA directed against GFP (Target sequence: 5'GCAAGCTGACCCTGAAGTTCAT3'). Used as control shRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 GFP shRNA was a gift from David Sabatini (Addgene plasmid # 30323 ; ; RRID:Addgene_30323)
  • For your References section:

    The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, Bar-Peled L, Sabatini DM. Science. 2008 Jun 13. 320(5882):1496-501. 10.1126/science.1157535 PubMed 18497260