Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSIH1-puro-control shRNA
(Plasmid #26597)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26597 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSIH1-H1-puro
  • Backbone manufacturer
    System Biosciences
  • Backbone size (bp) 7200
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    control shRNA
  • Insert Size (bp)
    60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agtgtcactaggcgggaacac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Control shRNA: AATAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTATTTTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIH1-puro-control shRNA was a gift from Frank Sinicrope (Addgene plasmid # 26597 ; http://n2t.net/addgene:26597 ; RRID:Addgene_26597)
  • For your References section:

    Sorafenib inhibits STAT3 activation to enhance TRAIL-mediated apoptosis in human pancreatic cancer cells. Huang S, Sinicrope FA. Mol Cancer Ther. 2010 Mar . 9(3):742-50. 10.1158/1535-7163.MCT-09-1004 PubMed 20197401