-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 26625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 puro
-
Backbone manufacturerAvailable at Addgene (#8453)
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRheb1 shRNA
-
Alt nameRheb1
-
gRNA/shRNA sequenceCCTCAGACATACTCCATAGAT
-
SpeciesH. sapiens (human)
-
Entrez GeneRHEB (a.k.a. RHEB2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA directed against Rheb1. Target sequence: 5'-CCTCAGACATACTCCATAGAT-3'.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 Rheb1 shRNA #1 was a gift from David Sabatini (Addgene plasmid # 26625 ; http://n2t.net/addgene:26625 ; RRID:Addgene_26625) -
For your References section:
The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, Bar-Peled L, Sabatini DM. Science. 2008 Jun 13. 320(5882):1496-501. 10.1126/science.1157535 PubMed 18497260