Skip to main content
Addgene

pLKO.1-puro-cfRab8a_2
(Plasmid #26707)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26707 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dog Rab8a RNAi
  • gRNA/shRNA sequence
    GGGCCCTCCCCCTCCAATACT
  • Species
    C. familiaris (dog RNAi)
  • Mutation
    Dog Rab8a RNAi.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dog Rab8a RNAi. RNAi target sequence located within the 3'-UTR of canine Rab8a, so only matches dog. RNAi target sequence is: GGGCCCTCCCCCTCCAATACT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro-cfRab8a_2 was a gift from Keith Mostov (Addgene plasmid # 26707 ; http://n2t.net/addgene:26707 ; RRID:Addgene_26707)
  • For your References section:

    A molecular network for de novo generation of the apical surface and lumen. Bryant DM, Datta A, Rodriguez-Fraticelli AE, Peranen J, Martin-Belmonte F, Mostov KE. Nat Cell Biol. 2010 Nov;12(11):1035-45. doi: 10.1038/ncb2106. Epub 2010 Oct 3. 10.1038/ncb2106 PubMed 20890297