Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-hSyn-eNpHR 3.0-EYFP
(Plasmid #26972)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26972 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV5 26972-AAV5 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4570
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 (rec A-) cells to avoid recombinations with the LTRs
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eNpHR 3.0
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1683
  • Mutation
    Trafficking Signal (TS) ER Export Signal
  • Promoter hSyn
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, AgeI (not destroyed)
  • 3′ cloning site EcoRI, HinDIII (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains the human synapsin I promoter.

For additional information please visit - http://www.optogenetics.org

Information for AAV5 (Catalog # 26972-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-hSyn-eNpHR 3.0-EYFP (#26972). In addition to the viral particles, you will also receive purified pAAV-hSyn-eNpHR 3.0-EYFP plasmid DNA.

hSyn-driven eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-eNpHR 3.0-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26972 ; http://n2t.net/addgene:26972 ; RRID:Addgene_26972)

    For viral preps, please replace (Addgene plasmid # 26972) in the above sentence with: (Addgene viral prep # 26972-AAV5)