- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 27369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLKO1
- Backbone size w/o insert (bp) 8500
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameshYAP2
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)50
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO1-5 (Common Sequencing Primers)
Resource Information
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
YAP shRNA sequence - 5'-CCGGCTG GTCAGAGATACTTCTTAACTCGAGTTAAGAAGTATCTCTGACCAGTTTTTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pLKO1-shYAP2 was a gift from Kunliang Guan (Addgene plasmid # 27369 ; http://n2t.net/addgene:27369 ; RRID:Addgene_27369)
- 
                For your References section: TEAD mediates YAP-dependent gene induction and growth control. Zhao B, Ye X, Yu J, Li L, Li W, Li S, Yu J, Lin JD, Wang CY, Chinnaiyan AM, Lai ZC, Guan KL. Genes Dev. 2008 Jul 15. 22(14):1962-71. 10.1101/gad.1664408 PubMed 18579750