p307HU
(Plasmid
#27386)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19 modified
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameunligated form of ligase ribozyme
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer T7 (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was
GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p307HU was a gift from David Bartel (Addgene plasmid # 27386 ; http://n2t.net/addgene:27386 ; RRID:Addgene_27386) -
For your References section:
Crystal structure of the catalytic core of an RNA-polymerase ribozyme. Shechner DM, Grant RA, Bagby SC, Koldobskaya Y, Piccirilli JA, Bartel DP. Science. 2009 Nov 27. 326(5957):1271-5. 10.1126/science.1174676 PubMed 19965478