-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonemVenus N1
-
Backbone manufacturerAddgene plasmid# 27793
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemAmber N1
-
Insert Size (bp)720
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Amber was created by mutating Tyrosine 67 in Venus to Cysteine (Y67C).
See Addgene's sequencing results for detailed MCS and Amber. This plasmid is designed to clone a gene of interest upstream and in-frame to create a C-terminal Amber fusion protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Amber N1 was a gift from Steven Vogel (Addgene plasmid # 27798 ; http://n2t.net/addgene:27798 ; RRID:Addgene_27798) -
For your References section:
Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988