Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CYP11A1 (3N9Z/3NA0)
(Plasmid #28118)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 28118 Plasmid sent as bacteria in agar stab 1 $65 *

* Login to view industry pricing.


  • Vector backbone
    pCW-LIC (Addgene plasmid 26098)
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6980
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    cytochrome P450, family 11, subfamily A, polypeptide 1
  • Alt name
    PDB: 3N9Z
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    CYP11A1 (a.k.a. CYP11A, CYPXIA1, P450SCC)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ligation-independent cloning (unknown if destroyed)
  • 3′ cloning site Ligation-independent cloning (unknown if destroyed)
  • 5′ sequencing primer pCW-SEQ-fwd (ACATCGTATAACGTTACTGG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CYP11A1 (3N9Z/3NA0) was a gift from Cheryl Arrowsmith (Addgene plasmid # 28118)