Skip to main content

tdp43-EGFP construct5
(Plasmid #28198)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 28198 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech Laboratories, Inc
  • Backbone size w/o insert (bp) 4694
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a in LB media at 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tar DNA binding protein
  • Alt name
    TDP43
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    471
  • Mutation
    aa257-414 only
  • GenBank ID
    NM_007375
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer AATGGGAGTTTGTTTTGGCA
  • 3′ sequencing primer ACGAGGGTGGGCCAGGGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tdp43-EGFP construct5 was a gift from Zuoshang Xu (Addgene plasmid # 28198 ; http://n2t.net/addgene:28198 ; RRID:Addgene_28198)
  • For your References section:

    The C-terminal TDP-43 fragments have a high aggregation propensity and harm neurons by a dominant-negative mechanism. Yang C, Tan W, Whittle C, Qiu L, Cao L, Akbarian S, Xu Z. PLoS One. 2010 . 5(12):e15878. 10.1371/journal.pone.0015878 PubMed 21209826