miR-TDP43b
(Plasmid
#28212)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 28212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-RFP-KX
- Backbone size w/o insert (bp) 6341
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a in LB media at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRNAb
-
Insert Size (bp)108
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer GCTGGACATCACCTCCCACAACG
- 3′ sequencing primer ACAGGAGGTGGGGAGCAGGAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR-TDP43b was a gift from Zuoshang Xu (Addgene plasmid # 28212 ; http://n2t.net/addgene:28212 ; RRID:Addgene_28212) -
For your References section:
The C-terminal TDP-43 fragments have a high aggregation propensity and harm neurons by a dominant-negative mechanism. Yang C, Tan W, Whittle C, Qiu L, Cao L, Akbarian S, Xu Z. PLoS One. 2010 . 5(12):e15878. 10.1371/journal.pone.0015878 PubMed 21209826