Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #29327)


Item Catalog # Description Quantity Price (USD)
Plasmid 29327 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Pfeiffer et al
  • Backbone size w/o insert (bp) 7831
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    D. melanogaster (fly)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer SV40 R: CCATTCATCAGTTCCATAGG
  • (Common Sequencing Primers)

Terms and Licenses

Depositor Comments

This plasmid contains mTFP1.0, and not EBFP2, as suggested by the linear plasmid map image file.

Please note that Addgene's sequencing results identified a few discrepancies when compared to GenBank ID JF267350. The depositing laboratory states that these differences are not a concern for the function of the plasmid. The full plasmid sequence has been assembled and not entirely confirmed by sequencing. Additional discrepancies may exist.

This plasmid was constructed using the following restriction enyzmes:
Bgl II / Not I - loxP sites
Not I / Xho I - EGFP-HSV
Xho I / Kpn I - mTFP1.0-HA
Kpn I / Xba I - mKO2-V5

NotI is not a unique cutter--it is present twice in the plasmid. The XbaI site has been confirmed by Addgene's sequencing results, but it not present in the full plasmid sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dBrainbow was a gift from Julie Simpson (Addgene plasmid # 29327 ; ; RRID:Addgene_29327)
  • For your References section:

    Drosophila Brainbow: a recombinase-based fluorescence labeling technique to subdivide neural expression patterns. Hampel S, Chung P, McKellar CE, Hall D, Looger LL, Simpson JH. Nat Methods. 2011 Feb 6. ():. 10.1038/nmeth.1566 PubMed 21297621