dBrainbow
(Plasmid #29327)

• Depositing Lab: Julie Simpson
• Publication: Hampel et al Nat Methods. 2011 Feb 6. ():.

Backbone

• Vector backbone: pJFRC-MUH
• Backbone manufacturer: Pfeiffer et al
• Backbone size w/o insert (bp): 7831
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UAS-Stop-GFP:HSV-mTFP1:HA-mKO2:V5
• Alt name: UAS-dBrainbow
• Species: D. melanogaster (fly)
• GenBank ID: JF267350.2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: Xba I (not destroyed)
• 5′ sequencing primer: hsp70 F: GAGCGCCGGAGTATAAATAGAG
• 3′ sequencing primer: SV40 R: CCATTCATCAGTTCCATAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid contains mTFP1.0, and not EBFP2, as suggested by the linear plasmid map image file.

Please note that Addgene's sequencing results identified a few discrepancies when compared to GenBank ID JF267350. The depositing laboratory states that these differences are not a concern for the function of the plasmid. The full plasmid sequence has been assembled and not entirely confirmed by sequencing. Additional discrepancies may exist.

This plasmid was constructed using the following restriction enyzmes:
Bgl II / Not I - loxP sites
Not I / Xho I - EGFP-HSV
Xho I / Kpn I - mTFP1.0-HA
Kpn I / Xba I - mKO2-V5

NotI is not a unique cutter--it is present twice in the plasmid. The XbaI site has been confirmed by Addgene's sequencing results, but it not present in the full plasmid sequence.