V5V
(Plasmid
#29423)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 29423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP C1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression ; Anisotropy and brightness standard
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVenus-5-Venus
-
Alt nameV5V
-
Insert Size (bp)1435
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Anisotropy standard and brightness standard
Linker sequence: TCCGGACTCAGATCT
Please note that digest with the enzymes used for cloning will not remove the full V5V insert from the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5V was a gift from Steven Vogel (Addgene plasmid # 29423 ; http://n2t.net/addgene:29423 ; RRID:Addgene_29423) -
For your References section:
Structural rearrangement of CaMKIIalpha catalytic domains encodes activation. Thaler C, Koushik SV, Puhl HL, Blank PS, Vogel SS. Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74. 10.1073/pnas.0901913106 PubMed 19339497