Skip to main content

pET LIC cloning vector (2A-T)
(Plasmid #29665)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29665 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 4731
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ cloning site LIC site v2 (destroyed during cloning)
  • 3′ cloning site LIC site v2 (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2A-T has no fusion tags, for those who want to express native protein.

To clone into this vector, add LIC v2 tags to the 5' end of your PCR primers.

Forward - 5'TTTAAGAAGGAGATATAGATC3'

Reverse - 5'TTATGGAGTTGGGATCTTATTA3'

Linearize the plasmid with EcoRV and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET LIC cloning vector (2A-T) was a gift from Scott Gradia (Addgene plasmid # 29665 ; http://n2t.net/addgene:29665 ; RRID:Addgene_29665)