-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET
- Backbone size (bp) 6289
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- His6-NusA-TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site LIC site (destroyed during cloning)
- 3′ cloning site LIC site (destroyed during cloning)
- 5′ sequencing primer NusA forward
- 3′ sequencing primer T7 reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2N-T has a TEV-cleavable N-terminal His6-NusA fusion tag. NusA can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET His6 NusA TEV LIC cloning vector (2N-T) was a gift from Scott Gradia (Addgene plasmid # 29709 ; http://n2t.net/addgene:29709 ; RRID:Addgene_29709)