Skip to main content

DYSF-Venus
(Plasmid #29768)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29768 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP N1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DYSF-Venus
  • Alt name
    Dysferlin-3HA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6328
  • GenBank ID
    NM_003494
  • Entrez Gene
    DYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)
  • Tag / Fusion Protein
    • Venus (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DYSF-Venus was a gift from Steven Vogel (Addgene plasmid # 29768 ; http://n2t.net/addgene:29768 ; RRID:Addgene_29768)
  • For your References section:

    Membrane wounding triggers ATP release and dysferlin-mediated intercellular calcium signaling. Covian-Nares JF, Koushik SV, Puhl HL, Vogel SS. J Cell Sci. 2010 Jun 1. 123(Pt 11):1884-93. 10.1242/jcs.066084 PubMed 20442251