Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #29780)


Item Catalog # Description Quantity Price (USD)
Plasmid 29780 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    PLKO (modified)
  • Backbone size w/o insert (bp) 9471
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    Low Copy


  • Gene/Insert name
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccgagggcctatttcccatgattcc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PLKO-mcherry-luc-puro-shSCR was a gift from Carl Novina (Addgene plasmid # 29780 ; ; RRID:Addgene_29780)
  • For your References section:

    Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Levy C, Khaled M, Iliopoulos D, Janas MM, Schubert S, Pinner S, Chen PH, Li S, Fletcher AL, Yokoyama S, Scott KL, Garraway LA, Song JS, Granter SR, Turley SJ, Fisher DE, Novina CD. Mol Cell. 2010 Dec 10. 40(5):841-9. 10.1016/j.molcel.2010.11.020 PubMed 21109473