-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePLKO (modified)
- Backbone size w/o insert (bp) 9469
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStabl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemiR-211
-
Insert Size (bp)116
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ccgagggcctatttcccatgattcc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLKO-mcherry-luc-puro-miR-211 was a gift from Carl Novina (Addgene plasmid # 29784 ; http://n2t.net/addgene:29784 ; RRID:Addgene_29784) -
For your References section:
Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Levy C, Khaled M, Iliopoulos D, Janas MM, Schubert S, Pinner S, Chen PH, Li S, Fletcher AL, Yokoyama S, Scott KL, Garraway LA, Song JS, Granter SR, Turley SJ, Fisher DE, Novina CD. Mol Cell. 2010 Dec 10. 40(5):841-9. 10.1016/j.molcel.2010.11.020 PubMed 21109473