Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

PLKO-mcherry-luc-puro-Renilla cDNA
(Plasmid #29783)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 29783 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PLKO modified
  • Backbone size w/o insert (bp) 9615
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stabl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Renilla
  • Species
    Renilla reniformis
  • Insert Size (bp)
    936

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ccggtatgacttcgaaagtttatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PLKO-mcherry-luc-puro-Renilla cDNA was a gift from Carl Novina (Addgene plasmid # 29783 ; http://n2t.net/addgene:29783 ; RRID:Addgene_29783)
  • For your References section:

    Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Levy C, Khaled M, Iliopoulos D, Janas MM, Schubert S, Pinner S, Chen PH, Li S, Fletcher AL, Yokoyama S, Scott KL, Garraway LA, Song JS, Granter SR, Turley SJ, Fisher DE, Novina CD. Mol Cell. 2010 Dec 10. 40(5):841-9. 10.1016/j.molcel.2010.11.020 PubMed 21109473