Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFastBac His6 MBP N10 TEV LIC cloning vector (4C)
(Plasmid #30116)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30116 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFastBac
  • Backbone size (bp) 5976
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • His6-MBP-N10-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer MBP F (5'ggtcgtcagactgtcgatgaagcc)
  • 3′ sequencing primer LICBac R (5'caggttcagggggaggtgtg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein.

Add the following tags to your PCR primers:

LicV1 Forward Tag TACTTCCAATCCAATGCA

LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac His6 MBP N10 TEV LIC cloning vector (4C) was a gift from Scott Gradia (Addgene plasmid # 30116 ; http://n2t.net/addgene:30116 ; RRID:Addgene_30116)