Skip to main content
Addgene

pR2HYG
(Plasmid #30170)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30170 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSP12::dsRed2
  • Backbone manufacturer
    Addgene Plasmid 30171
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • dsRed2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • 3′ sequencing primer dsRed1-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::dsRed2 by interupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.

Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#4947 when compared to the full sequence information provided by the depositing laboratory. This mismatch is not a concern for the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR2HYG was a gift from Lalita Ramakrishnan (Addgene plasmid # 30170 ; http://n2t.net/addgene:30170 ; RRID:Addgene_30170)