Skip to main content
Addgene
Open Menu

pR2HYG
(Plasmid #30170)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30170 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 30170-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 30170-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pMSP12::dsRed2
  • Backbone manufacturer
    Addgene Plasmid 30171
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • dsRed2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • 3′ sequencing primer dsRed1-N
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::dsRed2 by interupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.

Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#4947 when compared to the full sequence information provided by the depositing laboratory. This mismatch is not a concern for the function of the plasmid.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR2HYG was a gift from Lalita Ramakrishnan (Addgene plasmid # 30170 ; http://n2t.net/addgene:30170 ; RRID:Addgene_30170)
Related items:
Commonly requested with: