pR2HYG
(Plasmid
#30170)
-
Depositing Lab
-
Depositing OrganizationUniversity of Washington
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 30170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 30170-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 30170-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMSP12::dsRed2
-
Backbone manufacturerAddgene Plasmid 30171
-
Vector typeMycobacteria expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMycobacterium Strong Promoter (MSP)
-
SpeciesM. marinum
-
Insert Size (bp)500
-
Tag
/ Fusion Protein
- dsRed2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
- 3′ sequencing primer dsRed1-N
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was derived from pMSP12::dsRed2 by interupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.
Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#4947 when compared to the full sequence information provided by the depositing laboratory. This mismatch is not a concern for the function of the plasmid.
DNA (Catalog # 30170-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 30170-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR2HYG was a gift from Lalita Ramakrishnan (Addgene plasmid # 30170 ; http://n2t.net/addgene:30170 ; RRID:Addgene_30170)