pR2HYG
(Plasmid #30170)

• Depositing Lab: Lalita Ramakrishnan
• Publication: Ramakrishnan Lab Plasmids (unpublished)

Backbone

• Vector backbone: pMSP12::dsRed2
• Backbone manufacturer: Addgene Plasmid 30171
• Vector type: Mycobacteria expression

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mycobacterium Strong Promoter (MSP)
• Species: M. marinum
• Insert Size (bp): 500
• Tag / Fusion Protein:
  • dsRed2 (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
• 3′ sequencing primer: dsRed1-N

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was derived from pMSP12::dsRed2 by interupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.

Please note that Addgene's sequencing results identified a single nucleotide mismatch at bp#4947 when compared to the full sequence information provided by the depositing laboratory. This mismatch is not a concern for the function of the plasmid.