Skip to main content

pMSP12::Kaede
(Plasmid #30172)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30172 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFPV27
  • Backbone manufacturer
    Ramakrishnan et al., 2000
  • Backbone size w/o insert (bp) 4981
  • Vector type
    Mycobacteria expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mycobacterium Strong Promoter (MSP)
  • Species
    M. marinum
  • Insert Size (bp)
    500
  • Tag / Fusion Protein
    • Kaede (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was derived from pMSP12::GFP (Addgene plasmid # 30167) by replacing the GFP with Kaede.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSP12::Kaede was a gift from Lalita Ramakrishnan (Addgene plasmid # 30172 ; http://n2t.net/addgene:30172 ; RRID:Addgene_30172)
  • For your References section:

    The role of the granuloma in expansion and dissemination of early tuberculous infection. Davis JM, Ramakrishnan L. Cell. 2009 Jan 9. 136(1):37-49. 10.1016/j.cell.2008.11.014 PubMed 19135887