Skip to main content

Reduced Expression Alpha-5-Integrin-GFP
(Plasmid #30450)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30450 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha 5 integrin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3200
  • Mutation
    91-544 of enhancer region of CMV promoter removed to reduce expression
  • GenBank ID
    XO6256
  • Entrez Gene
    ITGA5 (a.k.a. CD49e, FNRA, VLA-5, VLA5A)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer AGCGGCACTCTGACTTGAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Reduced expression promoter was received from Dr. Tim Mitchison (Harvard Medical School). Alpha-5 integrin was received from Dr. Louis Reichardt (UCSF).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Reduced Expression Alpha-5-Integrin-GFP was a gift from Rick Horwitz (Addgene plasmid # 30450 ; http://n2t.net/addgene:30450 ; RRID:Addgene_30450)