Barkor Δ10
(Plasmid
#30500)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonephrGFP-N1
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 4300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBarkor
-
Alt nameATG14L/ATG14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1446
-
Mutation1-483aa
-
GenBank IDKIAA0831
-
Entrez GeneATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
-
Tags
/ Fusion Proteins
- hrGFP (N terminal on backbone)
- 3xFlag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Barkor Δ10 was a gift from Qing Zhong (Addgene plasmid # 30500 ; http://n2t.net/addgene:30500 ; RRID:Addgene_30500) -
For your References section:
Autophagosome targeting and membrane curvature sensing by Barkor/Atg14(L). Fan W, Nassiri A, Zhong Q. Proc Natl Acad Sci U S A. 2011 Apr 25. ():. 10.1073/pnas.1016472108 PubMed 21518905