Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

araC-pBAD-gusA-pBAV1k
(Plasmid #30502)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30502 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAV1k
  • Backbone size w/o insert (bp) 2792
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    beta-glucuronidase
  • Alt name
    gusA
  • Alt name
    pIM1441
  • Species
    Escherichia coli
  • Insert Size (bp)
    1796
  • GenBank ID
    JF828583
  • Entrez Gene
    gusA (a.k.a. ECO111_2086)
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI (not destroyed)
  • 3′ cloning site SpeI, PstI, HindIII, ClaI (not destroyed)
  • 5′ sequencing primer gacgaactccaattcactgttccttgc
  • 3′ sequencing primer ggagagcgttcaccgacaaacaacag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In our experience, plasmid yields are highest when cells are harvested at late log stage.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    araC-pBAD-gusA-pBAV1k was a gift from Ichiro Matsumura (Addgene plasmid # 30502 ; http://n2t.net/addgene:30502 ; RRID:Addgene_30502)
  • For your References section:

    Expression vectors for the engineering of genes and genomes in Acinetobacter baylyi ADP1. Murin CD, Segal K, Bryksin A, Matsumura I. Appl Environ Microbiol. 2011 Oct 21. 10.1128/AEM.05597-11 PubMed 22020504