Skip to main content

pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB
(Plasmid #30505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30505 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAV1k
  • Backbone size w/o insert (bp) 2792
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Any strain that has LacI repressor.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    beta-glucuronidase
  • Alt name
    gusA
  • Alt name
    pIM1463
  • Species
    Escherichia coli
  • Insert Size (bp)
    1796
  • Entrez Gene
    gusA (a.k.a. ECO111_2086)
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI (not destroyed)
  • 3′ cloning site SpeI, PstI (not destroyed)
  • 5′ sequencing primer gacgaactccaattcactgttccttgc
  • 3′ sequencing primer ggagagcgttcaccgacaaacaacag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This lab.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In our experience, plasmid yields are highest when cells are harvest at late log stage.

Note that this plasmid also confers resistance to Spectinomycin, but Addgene provides it in an Amp stab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB was a gift from Ichiro Matsumura (Addgene plasmid # 30505 ; http://n2t.net/addgene:30505 ; RRID:Addgene_30505)
  • For your References section:

    Expression vectors for the engineering of genes and genomes in Acinetobacter baylyi ADP1. Murin CD, Segal K, Bryksin A, Matsumura I. Appl Environ Microbiol. 2011 Oct 21. 10.1128/AEM.05597-11 PubMed 22020504