This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSUPER retro puro GFP shRNA
(Plasmid #30519)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30519 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSUPER retro puro
  • Backbone manufacturer
    OligoEngine
  • Backbone size w/o insert (bp) 6343
  • Modifications to backbone
    Linearized BlgII/HindIII
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP shRNA
  • Alt name
    GFP shRNA
  • Insert Size (bp)
    61

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSUPER retro puro GFP shRNA was a gift from John Gurdon (Addgene plasmid # 30519 ; http://n2t.net/addgene:30519 ; RRID:Addgene_30519)
  • For your References section:

    Histone variant macroH2A confers resistance to nuclear reprogramming. Pasque V, Gillich A, Garrett N, Gurdon JB. EMBO J. 2011 May 6. ():. 10.1038/emboj.2011.144 PubMed 21552206