Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTAL3
(Plasmid #31034)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31034 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin (50 ug/ml)
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a/LB+antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN-FokI nuclease backbone
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    1948
  • Tags / Fusion Proteins
    • FokI nuclease (C terminal on insert)
    • AcV5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TEF_seq (ggtcttcaatttctcaagtttc) TAL_F1 (ttggcgtcggcaaacagtgg)
  • 3′ sequencing primer homodimer_rev (aattcagatttcactagctg) TAL_R2 (ggcgacgaggtggtcgttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression of the TAL-FokI homodimer in yeast.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTAL3 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31034 ; http://n2t.net/addgene:31034 ; RRID:Addgene_31034)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Apr 14. ():. 10.1093/nar/gkr218 PubMed 21493687