Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTAL1
(Plasmid #31031)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31031 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR8-GW modified
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2676

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH10B/LB+antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALE
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    2101

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
  • 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttgg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway compatible vector for assembly of full-length TAL effector genes by Golden Gate cloning. Contains both SD and Kozak sequences immediately upstream of the initial ATG. Designed for TAL DNA-binding domains alone

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTAL1 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31031 ; http://n2t.net/addgene:31031 ; RRID:Addgene_31031)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687