Skip to main content
Addgene

pNK5
(Plasmid #31040)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31040 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTC14
  • Backbone size w/o insert (bp) 2989

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Top10/LB+antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    repeat NK5
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    111

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pTC14_F2 (caagcctgattgggagaaaa)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMPORTANT NOTE!: Restriction digests show that the pNK series of plasmids is actually about 2.5kb, not 3.1kb as the sequence-based map below suggests. All important features are present in the plasmid and the construct should function as reported despite this size discrepancy.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNK5 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31040 ; http://n2t.net/addgene:31040 ; RRID:Addgene_31040)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687