Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMG10
(Plasmid #31238)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31238 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Alt name
    CMV-FokI (+)-T2A-FokI (-)
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI for ZF1/ XbaI for ZF2 (destroyed during cloning)
  • 3′ cloning site BglII for ZF1/ BamHI for ZF2 (destroyed during cloning)
  • 5′ sequencing primer GCGGTAGGCGTGTACGGT
  • 3′ sequencing primer CTGGCAATTTCAATTAATTCAATAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    "+" and "-" FokI heterodimer mutations are derived from Miller et al., Nat. Biotech 2007, PMID 17603475.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The ‘2-in-1’ ZFN cassette in this plasmid is under control of a CMV promoter. Each ZFN contains an N-terminal triple FLAG tag. The ZFN subunits are separated by a sequence encoding the T2A autoproteinase

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMG10 was a gift from Keith Joung (Addgene plasmid # 31238 ; http://n2t.net/addgene:31238 ; RRID:Addgene_31238)
  • For your References section:

    Autonomous zinc-finger nuclease pairs for targeted chromosomal deletion. Soellu C, Pars K, Cornu TI, Thibodeau-Beganny S, Maeder ML, Joung JK, Heilbronn R, Cathomen T. Nucleic Acids Res. 2010 Dec 1. 38(22):8269-76. 10.1093/nar/gkq720 PubMed 20716517