pMG10
(Plasmid #31238)

• Purpose: (Empty Backbone)
• Depositing Lab: Keith Joung
• Publication: Soellu et al Nucleic Acids Res. 2010 Dec 1. 38(22):8269-76.

Backbone

• Vector backbone: pMG10
• Backbone size (bp): 6536
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None
• Alt name: CMV-FokI (+)-T2A-FokI (-)
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI for ZF1/ XbaI for ZF2 (destroyed during cloning)
• 3′ cloning site: BglII for ZF1/ BamHI for ZF2 (destroyed during cloning)
• 5′ sequencing primer: GCGGTAGGCGTGTACGGT
• 3′ sequencing primer: CTGGCAATTTCAATTAATTCAATAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: "+" and "-" FokI heterodimer mutations are derived from Miller et al., Nat. Biotech 2007, PMID 17603475.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ‘2-in-1’ ZFN cassette in this plasmid is under control of a CMV promoter. Each ZFN contains an N-terminal triple FLAG tag. The ZFN subunits are separated by a sequence encoding the T2A autoproteinase