-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMSCVNeo
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6500
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNkx2-1*
-
Alt nameNkx2-1 with silent mutations
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1118
-
MutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by engineering four silent mutations using QuikChange® Lightning Site-Directed Mutagenesis (Stratagene) and the following primers: 5’ GGTCCGACCATAAAGCAAAGTGGAGCAGGACATGGCGCCATAGTCCGAG 3’ 5’ CTCGGACTATGGCGCCATGTCCTGCTCCACTTTGCTTTATGGTCGGACC 3’ followed by sequence verification and cloning into the MSCV-Puro retroviral expression vector.
-
Entrez GeneNkx2-1 (a.k.a. Nkx2.1, T/EBP, Titf1, Ttf-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer pLXSN 5'
- 3′ sequencing primer MSCV rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-Nkx2-1*/Neo was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 31272 ; http://n2t.net/addgene:31272 ; RRID:Addgene_31272) -
For your References section:
Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965