Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MSCV-Nkx2-1*/Neo
(Plasmid #31272)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31272 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVNeo
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nkx2-1*
  • Alt name
    Nkx2-1 with silent mutations
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1118
  • Mutation
    A shNkx2-1 insensitive Nkx2-1 cDNA was created by engineering four silent mutations using QuikChange® Lightning Site-Directed Mutagenesis (Stratagene) and the following primers: 5’ GGTCCGACCATAAAGCAAAGTGGAGCAGGACATGGCGCCATAGTCCGAG 3’ 5’ CTCGGACTATGGCGCCATGTCCTGCTCCACTTTGCTTTATGGTCGGACC 3’ followed by sequence verification and cloning into the MSCV-Puro retroviral expression vector.
  • Entrez Gene
    Nkx2-1 (a.k.a. AV026640, Nkx2.1, T/EBP, Titf1, Ttf-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer pLXSN 5'
  • 3′ sequencing primer MSCV rev
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Nkx2-1*/Neo was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 31272 ; http://n2t.net/addgene:31272 ; RRID:Addgene_31272)
  • For your References section:

    Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965